BLASTN 2.2.22 [Sep-27-2009] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= GabiPD|125917|Name:HA02C19r|Hordeum vulgare|Barke (613 letters) Database: All nt+env_nt+patnt+pdbnt 39,826,516 sequences; 43,083,979,091 total letters Score E Sequences producing significant alignments: (bits) value dbj|AK336104.1| Triticum aestivum cDNA, clone: SET3_D21, culti... 1013 0.0 ref|XM_002455774.1| Sorghum bicolor hypothetical protein, mRNA 553 1e-154 gb|EA712021.1| Sequence 90900 from patent US 7365185 418 1e-113 dbj|AP003334.4| Oryza sativa Japonica Group genomic DNA, chrom... 418 1e-113 ref|XM_002282006.1| PREDICTED: Vitis vinifera hypothetical pro... 109 3e-20 emb|AM448162.1| Vitis vinifera contig VV78X232060.8, whole gen... 99.6 3e-17 gb|AACY022006692.1| Marine metagenome 1092343786936, whole gen... 95.6 4e-16 ref|XM_002526293.1| Ricinus communis ATP binding protein, puta... 91.7 6e-15 gb|AACY023040268.1| Marine metagenome ctg_1101667447619, whole... 83.8 2e-12 gb|FJ388886.1| Medicago truncatula plastid carbamoylphosphate ... 83.8 2e-12 gb|AC192352.2| Medicago truncatula chromosome 2 BAC clone mte1... 83.8 2e-12 gb|AACY021112773.1| Marine metagenome 1093016078230, whole gen... 81.8 6e-12 gb|AACY021209045.1| Marine metagenome 599055, whole genome sho... 81.8 6e-12 gb|CP000435.1| Synechococcus sp. CC9311, complete genome 81.8 6e-12 gb|AACY021171559.1| Marine metagenome 1092963090284, whole gen... 79.8 2e-11 gb|AACY023379070.1| Marine metagenome ctg_1101668186421, whole... 79.8 2e-11 gb|EZ082533.1| TSA: Zea mays contig18176, mRNA sequence 79.8 2e-11 gb|AACY020610604.1| Marine metagenome 1095515504463, whole gen... 75.8 4e-10 gb|AACY023005207.1| Marine metagenome ctg_1101667412558, whole... 75.8 4e-10 gb|ABSR01011506.1| Freshwater sediment metagenome lwMethylamin... 73.8 1e-09 gb|AACY021262055.1| Marine metagenome 1093018608123, whole gen... 73.8 1e-09 gb|AACY023016096.1| Marine metagenome ctg_1101667423447, whole... 73.8 1e-09 gb|AACY023045345.1| Marine metagenome ctg_1101667452696, whole... 73.8 1e-09 gb|AAUQ01046091.1| Epibiont metagenome ALV_LSB_282_F02.x01, wh... 71.9 6e-09 gb|AACY020249100.1| Marine metagenome 1096626822577, whole gen... 71.9 6e-09 gb|AACY020399108.1| Marine metagenome 1096626508328, whole gen... 71.9 6e-09 gb|AACY022318245.1| Marine metagenome 1092963407679, whole gen... 71.9 6e-09 gb|AAFY01000139.1| Metagenome sequence 3634298_fasta.screen.Co... 71.9 6e-09 gb|CP001337.1| Chloroflexus aggregans DSM 9485, complete genome 71.9 6e-09 gb|AACY020467342.1| Marine metagenome 1096626805928, whole gen... 69.9 2e-08 gb|AACY024002262.1| Marine metagenome 1096626173026, whole gen... 69.9 2e-08 gb|AACY022102587.1| Marine metagenome 821936, whole genome sho... 67.9 9e-08 gb|AACY023277026.1| Marine metagenome ctg_1101668084377, whole... 67.9 9e-08 gb|AACY023618071.1| Marine metagenome ctg_1101668425422, whole... 67.9 9e-08 gb|CP000828.1| Acaryochloris marina MBIC11017, complete genome 67.9 9e-08 gb|ABSR01000141.1| Freshwater sediment metagenome lwMethylamin... 65.9 4e-07 gb|AACY020986659.1| Marine metagenome 1095516055739, whole gen... 65.9 4e-07 gb|AACY022402391.1| Marine metagenome 1432261, whole genome sh... 65.9 4e-07 gb|AAUQ01030191.1| Epibiont metagenome Ctg11495.1, whole genom... 63.9 1e-06 gb|AAUQ01000245.1| Epibiont metagenome Ctg99.4, whole genome s... 63.9 1e-06 gb|AAUQ01000784.1| Epibiont metagenome Ctg99.5, whole genome s... 63.9 1e-06 gb|AAUQ01000926.1| Epibiont metagenome Ctg568.1, whole genome ... 63.9 1e-06 gb|AAUQ01002076.1| Epibiont metagenome Ctg2563.1, whole genome... 63.9 1e-06 gb|AAUQ01002450.1| Epibiont metagenome Ctg2467.1, whole genome... 63.9 1e-06 gb|AAUQ01046313.1| Epibiont metagenome ALV_LSB_297_H08.x01, wh... 63.9 1e-06 gb|AAUQ01038564.1| Epibiont metagenome ALV_LSB_137_C12.x01, wh... 63.9 1e-06 gb|AAUQ01048734.1| Epibiont metagenome ALV_LSA_332_P16.x01, wh... 63.9 1e-06 gb|AAUQ01081933.1| Epibiont metagenome ALV_LSA_349_A01_D01.y01... 63.9 1e-06 gb|AAUQ01110527.1| Epibiont metagenome ALV_LSB_088_C06.x01, wh... 63.9 1e-06 gb|AAUQ01111933.1| Epibiont metagenome ALV_LSA_392_A02_D03.x01... 63.9 1e-06 gb|AAUQ01122168.1| Epibiont metagenome ALV_LSA_333_B02_H08.x01... 63.9 1e-06 gb|AACY020160512.1| Marine metagenome 1096626183540, whole gen... 63.9 1e-06 gb|AACY020258059.1| Marine metagenome 1096626804978, whole gen... 63.9 1e-06 gb|AACY020276862.1| Marine metagenome 1096626824858, whole gen... 63.9 1e-06 gb|AACY020343708.1| Marine metagenome 1096626782629, whole gen... 63.9 1e-06 gb|AACY020373737.1| Marine metagenome 1096626469893, whole gen... 63.9 1e-06 gb|AACY020968179.1| Marine metagenome 1552789, whole genome sh... 63.9 1e-06 gb|AACY021930437.1| Marine metagenome 1095460262338, whole gen... 63.9 1e-06 gb|AACY021937921.1| Marine metagenome 1093017764283, whole gen... 63.9 1e-06 gb|AACY022354186.1| Marine metagenome 916954, whole genome sho... 63.9 1e-06 gb|AACY022592327.1| Marine metagenome 1499851, whole genome sh... 63.9 1e-06 gb|AACY023544334.1| Marine metagenome ctg_1101668351685, whole... 63.9 1e-06 gb|AACY022839781.1| Marine metagenome ctg_1101667247132, whole... 63.9 1e-06 gb|AACY023031068.1| Marine metagenome ctg_1101667438419, whole... 63.9 1e-06 gb|AACY023098414.1| Marine metagenome ctg_1101667505765, whole... 63.9 1e-06 gb|AACY023132949.1| Marine metagenome ctg_1101667540300, whole... 63.9 1e-06 gb|AACY023647843.1| Marine metagenome ctg_1101668455194, whole... 63.9 1e-06 ref|XM_002314422.1| Populus trichocarpa predicted protein, mRNA 63.9 1e-06 gb|AACY021056610.1| Marine metagenome 1566953, whole genome sh... 61.9 6e-06 gb|AACY021061391.1| Marine metagenome 1095460067767, whole gen... 61.9 6e-06 gb|AACY022243573.1| Marine metagenome 881449, whole genome sho... 61.9 6e-06 >dbj|AK336104.1| Triticum aestivum cDNA, clone: SET3_D21, cultivar: Chinese Spring Length = 3860 Score = 1013 bits (511), Expect = 0.0 Identities = 580/603 (96%) Frame = +1 / +1 Query: 11 cttgactgggactgggaaaagataaaatatagcttacgtgtacctaatccagaccgtatc 70 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 1519 cttgactgggactgggaaaagataaaatatagcttacgtgtacctaatccagatcgtatc 1578 Query: 71 catgccgtgtatgctgctttcaagaaaggcatgagggttgaagaaatccatgaaattagc 130 ||||| || ||||||||||||||||||||||||||||||||||| || ||||||||||| Sbjct: 1579 catgctgtttatgctgctttcaagaaaggcatgagggttgaagacatacatgaaattagt 1638 Query: 131 tttattgataaatggttccttacagagctcaaggagctagttgatgttgagcagttcctt 190 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 1639 tttattgataaatggtttcttacagagctcaaggagctagttgatgttgagcagttcctt 1698 Query: 191 atttcaaagaaattagatgagctctcaaaagatgacttctatcaagtgaagaggaggggt 250 |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 1699 gtttcaaagaacttagaccagctctcaaaagatgacttctatcaagtgaagaggaggggt 1758 Query: 251 tttagtgacaatcagattgcatttgcgacgtcttcgtcggaaagtgatgtgagagcgaga 310 ||||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct: 1759 tttagtgacaagcagattgcatttgcgacatcttcgtcagaaagtgatgtgagagcgagg 1818 Query: 311 cgttctgcattaggtgtcattccaacatacaagcgtgttgatacctgtgccgctgagttt 370 |||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||| Sbjct: 1819 cgttctgcattaggagtcactccgacatacaagcgtgttgatacctgtgccgctgagttt 1878 Query: 371 gaagccaacaccccctatatgtactcttcatatgaatatgaatgcgagtcagctccaact 430 |||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 1879 gaagccaacaccccgtatatgtactcttcatatgagtatgaatgcgagtcagctccaact 1938 Query: 431 aatcggaagaaagtcttaatattgggtggtggacccaataggatagggcagggtattgag 490 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1939 aatcggaagaaagtcttaatattgggtggtggacccaataggatagggcagggtattgag 1998 Query: 491 tttgattactgctgttgccatgcctcatttgcgctccgagaggctggatatgagactata 550 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 1999 tttgattactgctgttgccatgcctcatttgcgctccgagaggccggatatgagactata 2058 Query: 551 atgatgaactctaatccggagactgtctcaactgactatgataccagcgaccgactgtac 610 ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 2059 atgatgaactccaatccggagactgtctcaactgactatgataccagcgaccggctgtac 2118 Query: 611 ttt 613 ||| Sbjct: 2119 ttt 2121 >ref|XM_002455774.1| Sorghum bicolor hypothetical protein, mRNA Length = 3841 Score = 553 bits (279), Expect = 1e-154 Identities = 510/587 (86%) Frame = +1 / +1 Query: 11 cttgactgggactgggaaaagataaaatatagcttacgtgtacctaatccagaccgtatc 70 ||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| Sbjct: 1453 cttgactgggactgggaaaagataaaatatagcttgcgggtacctaatccagatcgtatc 1512 Query: 71 catgccgtgtatgctgctttcaagaaaggcatgagggttgaagaaatccatgaaattagc 130 ||||| | || || ||||||||||||||||||||||| |||| ||||| ||||||||| Sbjct: 1513 catgctatctacgcagctttcaagaaaggcatgagggtccaagatatccacgaaattagc 1572 Query: 131 tttattgataaatggttccttacagagctcaaggagctagttgatgttgagcagttcctt 190 || ||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||| Sbjct: 1573 ttcattgacaaatggtttcttacagagctcaaggagctagtggatgttgagcagttcctt 1632 Query: 191 atttcaaagaaattagatgagctctcaaaagatgacttctatcaagtgaagaggaggggt 250 | |||| || ||||| || | ||||| |||||||| |||||||||||||||| ||| Sbjct: 1633 gtatcaaggagcctagatcagttgtcaaaggatgacttttatcaagtgaagaggaagggc 1692 Query: 251 tttagtgacaatcagattgcatttgcgacgtcttcgtcggaaagtgatgtgagagcgaga 310 ||||| ||||| |||||||||||||| || ||||| || ||||||||||||||| | || Sbjct: 1693 tttagcgacaagcagattgcatttgcaacttcttcatcagaaagtgatgtgagatcaagg 1752 Query: 311 cgttctgcattaggtgtcattccaacatacaagcgtgttgatacctgtgccgctgagttt 370 || | || ||||| || ||||||||| || ||||||||||| ||||| ||||||||| Sbjct: 1753 cgattggctttaggaatcgctccaacatataaacgtgttgatacttgtgctgctgagttt 1812 Query: 371 gaagccaacaccccctatatgtactcttcatatgaatatgaatgcgagtcagctccaact 430 |||||||| |||||||| ||||||||||| ||||| || ||||| || ||||||||||| Sbjct: 1813 gaagccaataccccctacatgtactcttcctatgagtacgaatgtgaatcagctccaacc 1872 Query: 431 aatcggaagaaagtcttaatattgggtggtggacccaataggatagggcagggtattgag 490 ||| ||||||| || | |||||||||||||| || ||| | ||||| ||||| |||||| Sbjct: 1873 aataggaagaaggtgctgatattgggtggtgggccaaatcgcataggccagggcattgag 1932 Query: 491 tttgattactgctgttgccatgcctcatttgcgctccgagaggctggatatgagactata 550 ||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||| Sbjct: 1933 tttgattactgctgttgccatgcatcatttgcacttcgagaggctggatatgagactatt 1992 Query: 551 atgatgaactctaatccggagactgtctcaactgactatgataccag 597 ||||||||||| ||||| ||||| |||||||||||||| |||||||| Sbjct: 1993 atgatgaactccaatcctgagacagtctcaactgactacgataccag 2039 >gb|EA712021.1| Sequence 90900 from patent US 7365185 Length = 1132 Score = 418 bits (211), Expect = 1e-113 Identities = 445/523 (85%) Frame = +1 / -1 Query: 11 cttgactgggactgggaaaagataaaatatagcttacgtgtacctaatccagaccgtatc 70 ||||||||||||||||||||| |||||||||| ||||| |||||||| ||||| || || Sbjct: 709 cttgactgggactgggaaaagttaaaatatagtttacgggtacctaacccagatcggatt 650 Query: 71 catgccgtgtatgctgctttcaagaaaggcatgagggttgaagaaatccatgaaattagc 130 ||||| | ||||| ||||| ||||||||||||||| || | || ||||||||||||||| Sbjct: 649 catgctatttatgcagcttttaagaaaggcatgaggattcaggatatccatgaaattagc 590 Query: 131 tttattgataaatggttccttacagagctcaaggagctagttgatgttgagcagttcctt 190 ||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||| Sbjct: 589 tttattgataaatggttccttactgagctcaaggagctagtggatgttgagcaattcctt 530 Query: 191 atttcaaagaaattagatgagctctcaaaagatgacttctatcaagtgaagaggaggggt 250 ||||||| | ||||| |||| ||||||||||||||||||||||||||| |||||||| Sbjct: 529 atttcaaggggcctagatcagctgtcaaaagatgacttctatcaagtgaagcggaggggt 470 Query: 251 tttagtgacaatcagattgcatttgcgacgtcttcgtcggaaagtgatgtgagagcgaga 310 |||||||||| |||||||| |||||||| ||||| || |||| |||||||||| || Sbjct: 469 tttagtgacacgcagattgcctttgcgacatcttcttcagaaactgatgtgagattaagg 410 Query: 311 cgttctgcattaggtgtcattccaacatacaagcgtgttgatacctgtgccgctgagttt 370 || ||| ||| || ||||||||||||||| |||||||| ||||| ||||||||| Sbjct: 409 cgcctggcactagaagttgctccaacatacaagcgggttgatacttgtgcggctgagttt 350 Query: 371 gaagccaacaccccctatatgtactcttcatatgaatatgaatgcgagtcagctccaact 430 |||||||| || || || ||||| || || ||||| |||||||| ||||| | ||||||| Sbjct: 349 gaagccaatacaccttacatgtattcctcgtatgagtatgaatgtgagtctgttccaact 290 Query: 431 aatcggaagaaagtcttaatattgggtggtggacccaataggatagggcagggtattgag 490 ||| ||| || || || || |||||||| || |||||| ||||||| |||||||||||| Sbjct: 289 aataagaaaaaggtgttgattttgggtggcgggcccaatcggataggccagggtattgag 230 Query: 491 tttgattactgctgttgccatgcctcatttgcgctccgagagg 533 |||||||| || ||||||||||| |||||||| || ||||||| Sbjct: 229 tttgattattgttgttgccatgcttcatttgcccttcgagagg 187 >dbj|AP003334.4| Oryza sativa Japonica Group genomic DNA, chromosome 1, BAC clone:B1114B07 Length = 148060 Score = 418 bits (211), Expect = 1e-113 Identities = 445/523 (85%) Frame = +1 / +1 Query: 11 cttgactgggactgggaaaagataaaatatagcttacgtgtacctaatccagaccgtatc 70 ||||||||||||||||||||| |||||||||| ||||| |||||||| ||||| || || Sbjct: 120756 cttgactgggactgggaaaagttaaaatatagtttacgggtacctaacccagatcggatt 120815 Query: 71 catgccgtgtatgctgctttcaagaaaggcatgagggttgaagaaatccatgaaattagc 130 ||||| | ||||| ||||| ||||||||||||||| || | || ||||||||||||||| Sbjct: 120816 catgctatttatgcagcttttaagaaaggcatgaggattcaggatatccatgaaattagc 120875 Query: 131 tttattgataaatggttccttacagagctcaaggagctagttgatgttgagcagttcctt 190 ||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||| Sbjct: 120876 tttattgataaatggttccttactgagctcaaggagctagtggatgttgagcaattcctt 120935 Query: 191 atttcaaagaaattagatgagctctcaaaagatgacttctatcaagtgaagaggaggggt 250 ||||||| | ||||| |||| ||||||||||||||||||||||||||| |||||||| Sbjct: 120936 atttcaaggggcctagatcagctgtcaaaagatgacttctatcaagtgaagcggaggggt 120995 Query: 251 tttagtgacaatcagattgcatttgcgacgtcttcgtcggaaagtgatgtgagagcgaga 310 |||||||||| |||||||| |||||||| ||||| || |||| |||||||||| || Sbjct: 120996 tttagtgacacgcagattgcctttgcgacatcttcttcagaaactgatgtgagattaagg 121055 Query: 311 cgttctgcattaggtgtcattccaacatacaagcgtgttgatacctgtgccgctgagttt 370 || ||| ||| || ||||||||||||||| |||||||| ||||| ||||||||| Sbjct: 121056 cgcctggcactagaagttgctccaacatacaagcgggttgatacttgtgcggctgagttt 121115 Query: 371 gaagccaacaccccctatatgtactcttcatatgaatatgaatgcgagtcagctccaact 430 |||||||| || || || ||||| || || ||||| |||||||| ||||| | ||||||| Sbjct: 121116 gaagccaatacaccttacatgtattcctcgtatgagtatgaatgtgagtctgttccaact 121175 Query: 431 aatcggaagaaagtcttaatattgggtggtggacccaataggatagggcagggtattgag 490 ||| ||| || || || || |||||||| || |||||| ||||||| |||||||||||| Sbjct: 121176 aataagaaaaaggtgttgattttgggtggcgggcccaatcggataggccagggtattgag 121235 Query: 491 tttgattactgctgttgccatgcctcatttgcgctccgagagg 533 |||||||| || ||||||||||| |||||||| || ||||||| Sbjct: 121236 tttgattattgttgttgccatgcttcatttgcccttcgagagg 121278 Score = 93.7 bits (47), Expect = 2e-15 Identities = 74/83 (89%) Frame = +1 / +1 Query: 531 aggctggatatgagactataatgatgaactctaatccggagactgtctcaactgactatg 590 ||||||||||||| ||||||||||||||||| || || ||||| || ||||||||||||| Sbjct: 121458 aggctggatatgaaactataatgatgaactccaacccagagacagtttcaactgactatg 121517 Query: 591 ataccagcgaccgactgtacttt 613 ||||||| ||||| |||||||| Sbjct: 121518 ataccagtgaccgtttgtacttt 121540 >ref|XM_002282006.1| PREDICTED: Vitis vinifera hypothetical protein LOC100262205 (LOC100262205), mRNA Length = 4050 Score = 109 bits (55), Expect = 3e-20 Identities = 202/251 (80%) Frame = +1 / +1 Query: 323 ggtgtcattccaacatacaagcgtgttgatacctgtgccgctgagtttgaagccaacacc 382 ||||||| |||| | || ||||| |||||||||||||| || |||||||| || || || Sbjct: 1804 ggtgtcactccagcctataagcgggttgatacctgtgctgcagagtttgaggctaatact 1863 Query: 383 ccctatatgtactcttcatatgaatatgaatgcgagtcagctccaactaatcggaagaaa 442 ||||||||||||||||| ||||| | ||||| || |||||||| ||| | ||||||| Sbjct: 1864 ccctatatgtactcttcttatgatttcgaatgtgaatcagctcccactcaaaggaagaag 1923 Query: 443 gtcttaatattgggtggtggacccaataggatagggcagggtattgagtttgattactgc 502 || ||||| || ||||| ||||| || |||| || || |||||||||||||| |||||| Sbjct: 1924 gttttaattttaggtggaggaccaaaccggattggtcaaggtattgagtttgactactgc 1983 Query: 503 tgttgccatgcctcatttgcgctccgagaggctggatatgagactataatgatgaactct 562 || || ||| | || ||||| |||| | || ||||||||||| || |||||||| || Sbjct: 1984 tgctgtcatacatcctttgctctccagaaagcaggatatgagacaatcatgatgaattca 2043 Query: 563 aatccggagac 573 ||||| ||||| Sbjct: 2044 aatcctgagac 2054 >emb|AM448162.1| Vitis vinifera contig VV78X232060.8, whole genome shotgun sequence Length = 38940 Score = 99.6 bits (50), Expect = 3e-17 Identities = 149/182 (81%) Frame = +1 / +1 Query: 323 ggtgtcattccaacatacaagcgtgttgatacctgtgccgctgagtttgaagccaacacc 382 ||||||| |||| | || ||||| |||||||||||||| || |||||||| || || || Sbjct: 22876 ggtgtcactccagcctataagcgggttgatacctgtgctgcagagtttgaggctaatact 22935 Query: 383 ccctatatgtactcttcatatgaatatgaatgcgagtcagctccaactaatcggaagaaa 442 ||||||||||||||||| ||||| | ||||| || |||||||| ||| | ||||||| Sbjct: 22936 ccctatatgtactcttcttatgatttcgaatgtgaatcagctcccactcaaaggaagaag 22995 Query: 443 gtcttaatattgggtggtggacccaataggatagggcagggtattgagtttgattactgc 502 || ||||| || ||||| ||||| || |||| || || |||||||||||||| |||||| Sbjct: 22996 gttttaattttaggtggaggaccaaaccggattggtcaaggtattgagtttgactactgc 23055 Query: 503 tg 504 || Sbjct: 23056 tg 23057 >gb|AACY022006692.1| Marine metagenome 1092343786936, whole genome shotgun sequence Length = 659 Score = 95.6 bits (48), Expect = 4e-16 Identities = 108/128 (84%) Frame = +1 / +1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgcgctc 526 ||||| || ||||| |||||||| ||||||||||| ||| |||||| ||| | || || Sbjct: 379 aatagaattgggcaaggtattgaatttgattactgttgtgtccatgcatcaatggcactt 438 Query: 527 cgagaggctggatatgagactataatgatgaactctaatccggagactgtctcaactgac 586 |||| ||||| ||||| || |||||||| |||| |||||| |||||||||||||||||| Sbjct: 439 agagatgctgggtatgaaacaataatgattaactgtaatccagagactgtctcaactgac 498 Query: 587 tatgatac 594 |||||||| Sbjct: 499 tatgatac 506 >ref|XM_002526293.1| Ricinus communis ATP binding protein, putative, mRNA Length = 3760 Score = 91.7 bits (46), Expect = 6e-15 Identities = 219/274 (79%), Gaps = 2/274 (0%) Frame = +1 / +1 Query: 331 tccaacatacaagcgtgttgatacctgtgccgctgagtttgaagccaacaccccctatat 390 |||| |||| ||||| || || |||||||| ||||||||||| || || || || ||||| Sbjct: 2014 tccagcatataagcgggtagacacctgtgctgctgagtttgaggctaatactccttatat 2073 Query: 391 gtactcttcatatgaatatgaatgcgagtcagctccaactaatcggaagaaagtcttaat 450 |||||| || ||||| ||| || || |||||||| || || ||| || || || || Sbjct: 2074 gtactcctcctatgatgctgagtgtgaatcagctcccaccaacaagaaaaaggttttgat 2133 Query: 451 attgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 || ||||| ||||| ||| | ||||| || || |||||||||||||||||||||||||| Sbjct: 2134 tttaggtggaggaccaaatcgtataggacaagggattgagtttgattactgctgttgcca 2193 Query: 511 tgcctcatttgcgctccgagag-gctggatatgagactataatgatgaactctaatccgg 569 | |||| ||||| |||| |||| || |||||||| || || |||||||| || ||||| | Sbjct: 2194 tacctcttttgctctcc-agagtgcaggatatgaaacaattatgatgaattcaaatcctg 2252 Query: 570 agactgtctcaactgactatgataccagcgaccg 603 | || || |||||||| |||||||| || ||||| Sbjct: 2253 aaaccgtatcaactgattatgatacaagtgaccg 2286 >gb|AACY023040268.1| Marine metagenome ctg_1101667447619, whole genome shotgun sequence Length = 909 Score = 83.8 bits (42), Expect = 2e-12 Identities = 111/134 (82%) Frame = +1 / +1 Query: 458 ggtggacccaataggatagggcagggtattgagtttgattactgctgttgccatgcctca 517 ||||| |||||||| || || || |||||||| || |||||||| ||| ||||| ||| Sbjct: 776 ggtggtcccaatagaattggccaaggtattgaattcgattactgttgtgttcatgcatca 835 Query: 518 tttgcgctccgagaggctggatatgagactataatgatgaactctaatccggagactgtc 577 | || ||| |||| ||||| |||||||| |||||||| |||| |||||| ||||||||| Sbjct: 836 atggcactcagagatgctggctatgagacgataatgattaactgtaatccagagactgtc 895 Query: 578 tcaactgactatga 591 ||||| |||||||| Sbjct: 896 tcaacggactatga 909 >gb|FJ388886.1| Medicago truncatula plastid carbamoylphosphate synthetase large subunit (CPSl) mRNA, complete cds; nuclear gene for plastid product Length = 3834 Score = 83.8 bits (42), Expect = 2e-12 Identities = 135/166 (81%) Frame = +1 / +1 Query: 330 ttccaacatacaagcgtgttgatacctgtgccgctgagtttgaagccaacaccccctata 389 ||||| |||| ||||| |||||||||||||| || |||||||||||||| || || |||| Sbjct: 1815 ttccagcatataagcgagttgatacctgtgctgcagagtttgaagccaatactccttata 1874 Query: 390 tgtactcttcatatgaatatgaatgcgagtcagctccaactaatcggaagaaagtcttaa 449 ||||||| || ||||| | ||| || || |||||||| |||| | ||||| || || | Sbjct: 1875 tgtactcatcttatgattttgagtgtgaatcagctcccactacaagaaagaaggttttga 1934 Query: 450 tattgggtggtggacccaataggatagggcagggtattgagtttga 495 | |||||||| ||||| ||||| || || || || ||||||||||| Sbjct: 1935 ttttgggtggaggaccaaatagaatcggtcaagggattgagtttga 1980 >gb|AC192352.2| Medicago truncatula chromosome 2 BAC clone mte1-82k18, complete sequence Length = 79460 Score = 83.8 bits (42), Expect = 2e-12 Identities = 135/166 (81%) Frame = +1 / +1 Query: 330 ttccaacatacaagcgtgttgatacctgtgccgctgagtttgaagccaacaccccctata 389 ||||| |||| ||||| |||||||||||||| || |||||||||||||| || || |||| Sbjct: 33000 ttccagcatataagcgagttgatacctgtgctgcagagtttgaagccaatactccttata 33059 Query: 390 tgtactcttcatatgaatatgaatgcgagtcagctccaactaatcggaagaaagtcttaa 449 ||||||| || ||||| | ||| || || |||||||| |||| | ||||| || || | Sbjct: 33060 tgtactcatcttatgattttgagtgtgaatcagctcccactacaagaaagaaggttttga 33119 Query: 450 tattgggtggtggacccaataggatagggcagggtattgagtttga 495 | |||||||| ||||| ||||| || || || || ||||||||||| Sbjct: 33120 ttttgggtggaggaccaaatagaatcggtcaagggattgagtttga 33165 >gb|AACY021112773.1| Marine metagenome 1093016078230, whole genome shotgun sequence Length = 611 Score = 81.8 bits (41), Expect = 6e-12 Identities = 113/137 (82%) Frame = +1 / -1 Query: 458 ggtggacccaataggatagggcagggtattgagtttgattactgctgttgccatgcctca 517 ||||| || |||||||| ||||| |||||||||||||||||||||||| || || || Sbjct: 291 ggtggtcctaataggattgggcaaggtattgagtttgattactgctgtgttcacgcatct 232 Query: 518 tttgcgctccgagaggctggatatgagactataatgatgaactctaatccggagactgtc 577 | ||||| |||| ||||| ||||| || |||||||| |||| |||||| ||||| || Sbjct: 231 atggcgcttagagatgctggctatgaaacaataatgatcaactgtaatccagagaccgtt 172 Query: 578 tcaactgactatgatac 594 ||||| ||||||||||| Sbjct: 171 tcaaccgactatgatac 155 >gb|AACY021209045.1| Marine metagenome 599055, whole genome shotgun sequence Length = 864 Score = 81.8 bits (41), Expect = 6e-12 Identities = 56/61 (91%) Frame = +1 / -1 Query: 447 taatattgggtggtggacccaataggatagggcagggtattgagtttgattactgctgtt 506 ||||||||||||||||||||||||| ||||| || || |||||||||||||| ||||||| Sbjct: 129 taatattgggtggtggacccaatagaataggacaaggaattgagtttgattattgctgtt 70 Query: 507 g 507 | Sbjct: 69 g 69 >gb|CP000435.1| Synechococcus sp. CC9311, complete genome Length = 2606748 Score = 81.8 bits (41), Expect = 6e-12 Identities = 59/65 (90%) Frame = +1 / +1 Query: 452 ttgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgccat 511 |||||||||||||| ||| |||| |||||||||||||| ||||||||||| |||||||| Sbjct: 1083351 ttgggtggtggacctaatcggattgggcagggtattgaatttgattactgttgttgccac 1083410 Query: 512 gcctc 516 ||||| Sbjct: 1083411 gcctc 1083415 >gb|AACY021171559.1| Marine metagenome 1092963090284, whole genome shotgun sequence Length = 774 Score = 79.8 bits (40), Expect = 2e-11 Identities = 52/56 (92%) Frame = +1 / -1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 ||||||||||| ||||| || || |||||||||||||||||||||||||||||||| Sbjct: 239 ggtggtggacctaatagaattggccagggtattgagtttgattactgctgttgcca 184 >gb|AACY023379070.1| Marine metagenome ctg_1101668186421, whole genome shotgun sequence Length = 1645 Score = 79.8 bits (40), Expect = 2e-11 Identities = 115/140 (82%) Frame = +1 / -1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgccatgcc 514 |||||||| || ||||| || ||||| ||||| || ||||||||||| ||| |||||| Sbjct: 1645 ggtggtggtcctaatagaattgggcaaggtatcgaatttgattactgttgtgtccatgca 1586 Query: 515 tcatttgcgctccgagaggctggatatgagactataatgatgaactctaatccggagact 574 ||| | || || |||| ||||| ||||| || |||||||| || | |||||| |||||| Sbjct: 1585 tcaatggcacttagagatgctggctatgaaacaataatgattaattgtaatccagagact 1526 Query: 575 gtctcaactgactatgatac 594 |||||||| ||||||||||| Sbjct: 1525 gtctcaaccgactatgatac 1506 >gb|EZ082533.1| TSA: Zea mays contig18176, mRNA sequence Length = 99 Score = 79.8 bits (40), Expect = 2e-11 Identities = 70/80 (87%) Frame = +1 / +1 Query: 362 gctgagtttgaagccaacaccccctatatgtactcttcatatgaatatgaatgcgagtca 421 ||||| |||||||||||||||||||| ||||||||||| ||||| || ||||| || ||| Sbjct: 5 gctgaatttgaagccaacaccccctacatgtactcttcctatgagtacgaatgtgaatca 64 Query: 422 gctccaactaatcggaagaa 441 ||||||| ||| ||||||| Sbjct: 65 tctccaaccaataggaagaa 84 >gb|AACY020610604.1| Marine metagenome 1095515504463, whole genome shotgun sequence Length = 720 Score = 75.8 bits (38), Expect = 4e-10 Identities = 50/54 (92%) Frame = +1 / +1 Query: 541 tgagactataatgatgaactctaatccggagactgtctcaactgactatgatac 594 ||||||||||||||| |||| |||||| |||||||||||||||||||| ||||| Sbjct: 8 tgagactataatgattaactgtaatccagagactgtctcaactgactacgatac 61 >gb|AACY023005207.1| Marine metagenome ctg_1101667412558, whole genome shotgun sequence Length = 796 Score = 75.8 bits (38), Expect = 4e-10 Identities = 53/58 (91%) Frame = +1 / +1 Query: 453 tgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 ||||||||||||| ||||| ||||| || || |||||||||||||||||||||||||| Sbjct: 206 tgggtggtggacctaatagaataggccaaggaattgagtttgattactgctgttgcca 263 >gb|ABSR01011506.1| Freshwater sediment metagenome lwMethylamine_BCHP6496_g1, whole genome shotgun sequence Length = 601 Score = 73.8 bits (37), Expect = 1e-09 Identities = 61/69 (88%) Frame = +1 / +1 Query: 338 tacaagcgtgttgatacctgtgccgctgagtttgaagccaacaccccctatatgtactct 397 ||||||||||| ||||||||||| ||||||||| | ||||||| |||||||||||||| Sbjct: 89 tacaagcgtgtagatacctgtgctgctgagttttcaaccaacacagcctatatgtactct 148 Query: 398 tcatatgaa 406 |||||||| Sbjct: 149 acatatgaa 157 >gb|AACY021262055.1| Marine metagenome 1093018608123, whole genome shotgun sequence Length = 981 Score = 73.8 bits (37), Expect = 1e-09 Identities = 103/125 (82%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgcgctc 526 ||||| || ||||| |||||||| ||||||||||| ||| |||||| ||| | || || Sbjct: 151 aatagaattgggcaaggtattgaatttgattactgttgtgtccatgcatcaatggcactt 92 Query: 527 cgagaggctggatatgagactataatgatgaactctaatccggagactgtctcaactgac 586 |||| ||||| ||||| || |||||||| |||| |||||| ||||| |||||||| ||| Sbjct: 91 agagatgctgggtatgaaacaataatgattaactgtaatccagagaccgtctcaaccgac 32 Query: 587 tatga 591 ||||| Sbjct: 31 tatga 27 >gb|AACY023016096.1| Marine metagenome ctg_1101667423447, whole genome shotgun sequence Length = 848 Score = 73.8 bits (37), Expect = 1e-09 Identities = 58/65 (89%) Frame = +1 / -1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgccatgcc 514 ||||| ||||| |||||||| |||||||| || || |||||||| ||||||||||||||| Sbjct: 530 ggtggaggaccaaataggattgggcagggaatagaatttgattattgctgttgccatgcc 471 Query: 515 tcatt 519 ||||| Sbjct: 470 tcatt 466 >gb|AACY023045345.1| Marine metagenome ctg_1101667452696, whole genome shotgun sequence Length = 955 Score = 73.8 bits (37), Expect = 1e-09 Identities = 49/53 (92%) Frame = +1 / +1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttg 507 ||||||||||| || ||||||||||| || ||||||||||||||||||||||| Sbjct: 693 ggtggtggaccaaacaggatagggcaaggaattgagtttgattactgctgttg 745 >gb|AAUQ01046091.1| Epibiont metagenome ALV_LSB_282_F02.x01, whole genome shotgun sequence Length = 1237 Score = 71.9 bits (36), Expect = 6e-09 Identities = 51/56 (91%) Frame = +1 / +1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| ||| ||||||||||| Sbjct: 138 aataggatagggcagggaattgagtttgactactgctgtgtccacgcctcatttgc 193 >gb|AACY020249100.1| Marine metagenome 1096626822577, whole genome shotgun sequence Length = 2156 Score = 71.9 bits (36), Expect = 6e-09 Identities = 51/56 (91%) Frame = +1 / +1 Query: 539 tatgagactataatgatgaactctaatccggagactgtctcaactgactatgatac 594 ||||||||||||||||| || | |||||||||||||||||||| ||||||||||| Sbjct: 1343 tatgagactataatgattaattgcaatccggagactgtctcaacagactatgatac 1398 >gb|AACY020399108.1| Marine metagenome 1096626508328, whole genome shotgun sequence Length = 1493 Score = 71.9 bits (36), Expect = 6e-09 Identities = 57/64 (89%) Frame = +1 / -1 Query: 447 taatattgggtggtggacccaataggatagggcagggtattgagtttgattactgctgtt 506 ||||||||||||| || |||||||| ||||| || || |||||||||||||| ||||||| Sbjct: 685 taatattgggtggagggcccaatagaataggacaaggaattgagtttgattattgctgtt 626 Query: 507 gcca 510 |||| Sbjct: 625 gcca 622 >gb|AACY022318245.1| Marine metagenome 1092963407679, whole genome shotgun sequence Length = 935 Score = 71.9 bits (36), Expect = 6e-09 Identities = 51/56 (91%) Frame = +1 / -1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 |||||||||||||| ||||||| || || |||||||||||||||||||||||||| Sbjct: 659 ggtggtggacccaaccggataggacaaggaattgagtttgattactgctgttgcca 604 >gb|AAFY01000139.1| Metagenome sequence 3634298_fasta.screen.Contig6661, whole genome shotgun sequence Length = 3107 Score = 71.9 bits (36), Expect = 6e-09 Identities = 60/68 (88%) Frame = +1 / +1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgccatgcc 514 ||||||||||| ||||| ||||| ||||| |||||||||||||| || ||||| ||||| Sbjct: 1675 ggtggtggacctaatagaataggtcaggggattgagtttgattattgttgttgtcatgct 1734 Query: 515 tcatttgc 522 |||||||| Sbjct: 1735 tcatttgc 1742 >gb|CP001337.1| Chloroflexus aggregans DSM 9485, complete genome Length = 4684931 Score = 71.9 bits (36), Expect = 6e-09 Identities = 42/44 (95%) Frame = +1 / +1 Query: 471 ggatagggcagggtattgagtttgattactgctgttgccatgcc 514 |||| |||||||||||||||||||||||||||||| |||||||| Sbjct: 2978163 ggatcgggcagggtattgagtttgattactgctgtagccatgcc 2978206 >gb|AACY020467342.1| Marine metagenome 1096626805928, whole genome shotgun sequence Length = 2158 Score = 69.9 bits (35), Expect = 2e-08 Identities = 53/59 (89%) Frame = +1 / +1 Query: 449 atattgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttg 507 ||||| ||||||||||| ||||| || || || |||||||||||||||||||||||||| Sbjct: 1234 atattaggtggtggacctaatagaattggtcaaggtattgagtttgattactgctgttg 1292 >gb|AACY024002262.1| Marine metagenome 1096626173026, whole genome shotgun sequence Length = 870 Score = 69.9 bits (35), Expect = 2e-08 Identities = 50/55 (90%) Frame = +1 / -1 Query: 453 tgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttg 507 ||||||||||||| ||||| ||||| || || ||||||||||||||||||||||| Sbjct: 233 tgggtggtggacctaatagaataggccaaggaattgagtttgattactgctgttg 179 >gb|AACY022102587.1| Marine metagenome 821936, whole genome shotgun sequence Length = 818 Score = 67.9 bits (34), Expect = 9e-08 Identities = 52/58 (89%) Frame = +1 / -1 Query: 453 tgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 ||||||||||||| ||||| ||||| || || ||||||||||||||||| |||||||| Sbjct: 788 tgggtggtggaccaaatagaataggccaaggaattgagtttgattactgttgttgcca 731 >gb|AACY023277026.1| Marine metagenome ctg_1101668084377, whole genome shotgun sequence Length = 1047 Score = 67.9 bits (34), Expect = 9e-08 Identities = 70/82 (85%) Frame = +1 / -1 Query: 429 ctaatcggaagaaagtcttaatattgggtggtggacccaataggatagggcagggtattg 488 ||||||| |||||| | |||| || |||||||| |||||||||||||| || || |||| Sbjct: 896 ctaatcgaaagaaaattataattttaggtggtgggcccaataggataggtcaaggaattg 837 Query: 489 agtttgattactgctgttgcca 510 | |||||||| ||||||||||| Sbjct: 836 aatttgattattgctgttgcca 815 >gb|AACY023618071.1| Marine metagenome ctg_1101668425422, whole genome shotgun sequence Length = 1036 Score = 67.9 bits (34), Expect = 9e-08 Identities = 55/62 (88%) Frame = +1 / -1 Query: 449 atattgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgc 508 ||||| ||||||||||| ||||| || || ||||| |||||||||||||||||||| ||| Sbjct: 836 atattaggtggtggaccaaatagaattggtcagggaattgagtttgattactgctgctgc 777 Query: 509 ca 510 || Sbjct: 776 ca 775 >gb|CP000828.1| Acaryochloris marina MBIC11017, complete genome Length = 6503724 Score = 67.9 bits (34), Expect = 9e-08 Identities = 37/38 (97%) Frame = +1 / -1 Query: 479 cagggtattgagtttgattactgctgttgccatgcctc 516 ||||||||||||||||| |||||||||||||||||||| Sbjct: 5471150 cagggtattgagtttgactactgctgttgccatgcctc 5471113 >gb|ABSR01000141.1| Freshwater sediment metagenome lwMethylamine_C141, whole genome shotgun sequence Length = 6532 Score = 65.9 bits (33), Expect = 4e-07 Identities = 60/69 (86%) Frame = +1 / -1 Query: 338 tacaagcgtgttgatacctgtgccgctgagtttgaagccaacaccccctatatgtactct 397 ||||||||||| ||||||||||| ||||||||| | ||||||| |||||||||||||| Sbjct: 3729 tacaagcgtgtagatacctgtgctgctgagttttcaaccaacacagcctatatgtactct 3670 Query: 398 tcatatgaa 406 | |||||| Sbjct: 3669 acttatgaa 3661 >gb|AACY020986659.1| Marine metagenome 1095516055739, whole genome shotgun sequence Length = 873 Score = 65.9 bits (33), Expect = 4e-07 Identities = 48/53 (90%) Frame = +1 / +1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttg 507 ||||||||||| ||||| ||||| ||||| |||||||||||||| |||||||| Sbjct: 542 ggtggtggacctaatagaataggtcagggaattgagtttgattattgctgttg 594 >gb|AACY022402391.1| Marine metagenome 1432261, whole genome shotgun sequence Length = 853 Score = 65.9 bits (33), Expect = 4e-07 Identities = 93/113 (82%) Frame = +1 / -1 Query: 482 ggtattgagtttgattactgctgttgccatgcctcatttgcgctccgagaggctggatat 541 |||||||| |||||||| || || ||||| ||| | ||| |||| |||| |||| | | Sbjct: 531 ggtattgaatttgattattgttgctgccaagccagttatgctctccaagagtctggcttt 472 Query: 542 gagactataatgatgaactctaatccggagactgtctcaactgactatgatac 594 |||||||||||||| |||| |||||| || |||||||| |||||||| ||||| Sbjct: 471 gagactataatgattaactgtaatccagaaactgtctcgactgactacgatac 419 >gb|AAUQ01030191.1| Epibiont metagenome Ctg11495.1, whole genome shotgun sequence Length = 1368 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 132 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 77 >gb|AAUQ01000245.1| Epibiont metagenome Ctg99.4, whole genome shotgun sequence Length = 5819 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 4034 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 3979 >gb|AAUQ01000784.1| Epibiont metagenome Ctg99.5, whole genome shotgun sequence Length = 3881 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 2439 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 2384 >gb|AAUQ01000926.1| Epibiont metagenome Ctg568.1, whole genome shotgun sequence Length = 3636 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 1230 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 1175 >gb|AAUQ01002076.1| Epibiont metagenome Ctg2563.1, whole genome shotgun sequence Length = 2629 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 1517 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 1462 >gb|AAUQ01002450.1| Epibiont metagenome Ctg2467.1, whole genome shotgun sequence Length = 2474 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / +1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 1104 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 1159 >gb|AAUQ01046313.1| Epibiont metagenome ALV_LSB_297_H08.x01, whole genome shotgun sequence Length = 1236 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 222 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 167 >gb|AAUQ01038564.1| Epibiont metagenome ALV_LSB_137_C12.x01, whole genome shotgun sequence Length = 1290 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 218 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 163 >gb|AAUQ01048734.1| Epibiont metagenome ALV_LSA_332_P16.x01, whole genome shotgun sequence Length = 1220 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 331 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 276 >gb|AAUQ01081933.1| Epibiont metagenome ALV_LSA_349_A01_D01.y01, whole genome shotgun sequence Length = 939 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 187 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 132 >gb|AAUQ01110527.1| Epibiont metagenome ALV_LSB_088_C06.x01, whole genome shotgun sequence Length = 672 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 246 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 191 >gb|AAUQ01111933.1| Epibiont metagenome ALV_LSA_392_A02_D03.x01, whole genome shotgun sequence Length = 657 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / +1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 79 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 134 >gb|AAUQ01122168.1| Epibiont metagenome ALV_LSA_333_B02_H08.x01, whole genome shotgun sequence Length = 516 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 467 aataggatagggcagggtattgagtttgattactgctgttgccatgcctcatttgc 522 ||||||||||||||||| ||||||||||| ||||||||| || ||||||||||| Sbjct: 335 aataggatagggcagggaattgagtttgactactgctgtgttcacgcctcatttgc 280 >gb|AACY020160512.1| Marine metagenome 1096626183540, whole genome shotgun sequence Length = 1516 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / +1 Query: 449 atattgggtggtggacccaataggatagggcagggtattgagtttgattactgctg 504 ||||| ||||||||||| ||||| || || || ||||||||||||||||||||||| Sbjct: 1166 atattaggtggtggacctaatagaattggtcaaggtattgagtttgattactgctg 1221 >gb|AACY020258059.1| Marine metagenome 1096626804978, whole genome shotgun sequence Length = 2350 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 449 atattgggtggtggacccaataggatagggcagggtattgagtttgattactgctg 504 ||||| ||||||||||| ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 218 atattaggtggtggaccaaatagaataggacagggtattgaatttgattattgctg 163 >gb|AACY020276862.1| Marine metagenome 1096626824858, whole genome shotgun sequence Length = 2271 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 |||||||| |||||||||||||| || || ||||| |||||||| ||||||||||| Sbjct: 1378 ggtggtgggcccaataggataggccaaggaattgaatttgattattgctgttgcca 1323 >gb|AACY020343708.1| Marine metagenome 1096626782629, whole genome shotgun sequence Length = 2593 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 ||||||||||| ||||| || || || |||||||||||||||||||| |||||||| Sbjct: 1213 ggtggtggacctaatagaattggtcaaggtattgagtttgattactgttgttgcca 1158 >gb|AACY020373737.1| Marine metagenome 1096626469893, whole genome shotgun sequence Length = 1696 Score = 63.9 bits (32), Expect = 1e-06 Identities = 59/68 (86%) Frame = +1 / +1 Query: 449 atattgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgc 508 |||||||| |||||||| ||||| || || ||||||||||| ||||||||||| || || Sbjct: 1133 atattgggaggtggacctaatagaattggccagggtattgaatttgattactgttgctgt 1192 Query: 509 catgcctc 516 |||||||| Sbjct: 1193 catgcctc 1200 >gb|AACY020968179.1| Marine metagenome 1552789, whole genome shotgun sequence Length = 844 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / +1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 ||||||||||| ||||| ||||| || || ||||||||||||||||| |||||||| Sbjct: 104 ggtggtggaccaaatagaataggtcaaggaattgagtttgattactgttgttgcca 159 >gb|AACY021930437.1| Marine metagenome 1095460262338, whole genome shotgun sequence Length = 732 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / +1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 ||||||||||| || || ||||| || || |||||||||||||||||||||||||| Sbjct: 18 ggtggtggaccaaacagaataggccaaggaattgagtttgattactgctgttgcca 73 >gb|AACY021937921.1| Marine metagenome 1093017764283, whole genome shotgun sequence Length = 823 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / +1 Query: 449 atattgggtggtggacccaataggatagggcagggtattgagtttgattactgctg 504 ||||| ||||||||||| ||||| || || || ||||||||||||||||||||||| Sbjct: 281 atattaggtggtggacctaatagaattggtcaaggtattgagtttgattactgctg 336 >gb|AACY022354186.1| Marine metagenome 916954, whole genome shotgun sequence Length = 808 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 ||||||||||| ||||| || || || ||||||||||||||||| ||||||||||| Sbjct: 594 ggtggtggacctaatagaattggccaaggtattgagtttgattattgctgttgcca 539 >gb|AACY022592327.1| Marine metagenome 1499851, whole genome shotgun sequence Length = 891 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 ||||||||||| ||||| ||||| || || ||||||||||||||||| |||||||| Sbjct: 869 ggtggtggaccaaatagaataggccaaggaattgagtttgattactgttgttgcca 814 >gb|AACY023544334.1| Marine metagenome ctg_1101668351685, whole genome shotgun sequence Length = 1176 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 452 ttgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttg 507 |||||||||||||| ||||| || || ||||||||||| ||||||||||| ||||| Sbjct: 410 ttgggtggtggaccaaatagaattggtcagggtattgaatttgattactgttgttg 355 >gb|AACY022839781.1| Marine metagenome ctg_1101667247132, whole genome shotgun sequence Length = 808 Score = 63.9 bits (32), Expect = 1e-06 Identities = 44/48 (91%) Frame = +1 / +1 Query: 458 ggtggacccaataggatagggcagggtattgagtttgattactgctgt 505 |||||||| ||||| ||||| || |||||||||||||||||||||||| Sbjct: 641 ggtggaccaaatagaataggtcaaggtattgagtttgattactgctgt 688 >gb|AACY023031068.1| Marine metagenome ctg_1101667438419, whole genome shotgun sequence Length = 961 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 |||||||| || ||||||||||| || || ||||||||||||||||| |||||||| Sbjct: 444 ggtggtgggccaaataggataggacaaggaattgagtttgattactgttgttgcca 389 >gb|AACY023098414.1| Marine metagenome ctg_1101667505765, whole genome shotgun sequence Length = 709 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / -1 Query: 452 ttgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttg 507 |||||||||||||| ||||| ||||| ||||| ||||| |||||||| |||||||| Sbjct: 392 ttgggtggtggaccaaatagaataggtcagggaattgaatttgattattgctgttg 337 >gb|AACY023132949.1| Marine metagenome ctg_1101667540300, whole genome shotgun sequence Length = 879 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / +1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgcca 510 ||||||||||| ||||| ||||| || || ||||||||||||||||| |||||||| Sbjct: 777 ggtggtggaccgaatagaataggccaaggaattgagtttgattactgttgttgcca 832 >gb|AACY023647843.1| Marine metagenome ctg_1101668455194, whole genome shotgun sequence Length = 999 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Frame = +1 / +1 Query: 539 tatgagactataatgatgaactctaatccggagactgtctcaactgactatgatac 594 ||||||||||||||||| || | ||||||||||||||| ||||| ||||| ||||| Sbjct: 491 tatgagactataatgattaattgtaatccggagactgtatcaacagactacgatac 546 >ref|XM_002314422.1| Populus trichocarpa predicted protein, mRNA Length = 3862 Score = 63.9 bits (32), Expect = 1e-06 Identities = 100/120 (83%), Gaps = 2/120 (1%) Frame = +1 / +1 Query: 455 ggtggtggacccaataggatagggcagggtattgagtttgattactgctgttgccatgcc 514 ||||| |||||||| | ||||| ||||| ||||||||||||||||| ||||||||||| Sbjct: 2056 ggtggaggacccaaccgtataggtcagggaattgagtttgattactgttgttgccatgca 2115 Query: 515 tcatttgcgctccgagag-gctggatatgagactataatgatgaactctaatccggagac 573 || ||| | || | |||| || ||||||||||| || |||||||| || ||||| ||||| Sbjct: 2116 tctttttccctgc-agagtgcaggatatgagacaattatgatgaattcaaatcctgagac 2174 Query: 574 573 Sbjct: 2175 2174 >gb|AACY021056610.1| Marine metagenome 1566953, whole genome shotgun sequence Length = 1007 Score = 61.9 bits (31), Expect = 6e-06 Identities = 57/67 (86%) Frame = +1 / +1 Query: 528 gagaggctggatatgagactataatgatgaactctaatccggagactgtctcaactgact 587 |||| ||||| ||||| || |||||||| |||| |||||| ||||||||||| || |||| Sbjct: 618 gagatgctggttatgaaacaataatgattaactgtaatccagagactgtctcgaccgact 677 Query: 588 atgatac 594 ||||||| Sbjct: 678 atgatac 684 >gb|AACY021061391.1| Marine metagenome 1095460067767, whole genome shotgun sequence Length = 861 Score = 61.9 bits (31), Expect = 6e-06 Identities = 52/59 (88%) Frame = +1 / +1 Query: 440 aaagtcttaatattgggtggtggacccaataggatagggcagggtattgagtttgatta 498 |||||| ||||||| ||||||||||| ||||| || ||||| |||||||| |||||||| Sbjct: 629 aaagtcataatattaggtggtggaccaaatagaattgggcaaggtattgaatttgatta 687 >gb|AACY022243573.1| Marine metagenome 881449, whole genome shotgun sequence Length = 932 Score = 61.9 bits (31), Expect = 6e-06 Identities = 49/55 (89%) Frame = +1 / -1 Query: 453 tgggtggtggacccaataggatagggcagggtattgagtttgattactgctgttg 507 ||||||||||||| ||||| ||||| || || ||||||||||||||||| ||||| Sbjct: 805 tgggtggtggacctaatagaataggccaaggaattgagtttgattactgttgttg 751 Database: All nt+env_nt+patnt+pdbnt Posted date: Mar 31, 2010 06:07 PM Number of letters in database: 43,083,979,091 Number of sequences in database: 39,826,516 Matrix: Search Statistics
